|
Left Crispr |
Right Crispr |
Crispr ID |
1100460180 |
1100460187 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:94791683-94791705
|
12:94791715-94791737
|
Sequence |
CCCTTGTTGAACAATGAGAACAC |
GGGAGGGAAACATCACACACTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 159, 1: 2935, 2: 10491, 3: 13062, 4: 9338} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|