ID: 1100460180_1100460187

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1100460180 1100460187
Species Human (GRCh38) Human (GRCh38)
Location 12:94791683-94791705 12:94791715-94791737
Sequence CCCTTGTTGAACAATGAGAACAC GGGAGGGAAACATCACACACTGG
Strand - +
Off-target summary No data {0: 159, 1: 2935, 2: 10491, 3: 13062, 4: 9338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!