ID: 1100460180_1100460188

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1100460180 1100460188
Species Human (GRCh38) Human (GRCh38)
Location 12:94791683-94791705 12:94791716-94791738
Sequence CCCTTGTTGAACAATGAGAACAC GGAGGGAAACATCACACACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!