ID: 1100481486_1100481488

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1100481486 1100481488
Species Human (GRCh38) Human (GRCh38)
Location 12:94983831-94983853 12:94983860-94983882
Sequence CCACAGAGATGCTTTAAAAATGT GAGTGCAAAAGTCATTAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 60, 4: 509} {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!