ID: 1100499510_1100499512

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1100499510 1100499512
Species Human (GRCh38) Human (GRCh38)
Location 12:95160336-95160358 12:95160371-95160393
Sequence CCACACAATGGCTATAATAAAAA GTAAATACCTAGTGTTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 76, 4: 454} {0: 1, 1: 0, 2: 12, 3: 232, 4: 975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!