ID: 1100540000_1100540005

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1100540000 1100540005
Species Human (GRCh38) Human (GRCh38)
Location 12:95548734-95548756 12:95548761-95548783
Sequence CCAATCGCCGCGGCCGCGCGCCC GCACACTCACCAGCCCGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 207} {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!