|
Left Crispr |
Right Crispr |
| Crispr ID |
1100567063 |
1100567066 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:95806646-95806668
|
12:95806662-95806684
|
| Sequence |
CCTCACCAGACATCTAATCTGCT |
ATCTGCTGCTGCCTTGATGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 28, 2: 325, 3: 1147, 4: 2150} |
{0: 1, 1: 0, 2: 25, 3: 303, 4: 996} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|