ID: 1100580561_1100580565

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1100580561 1100580565
Species Human (GRCh38) Human (GRCh38)
Location 12:95935752-95935774 12:95935780-95935802
Sequence CCAATAAATACTAATTCCTTGTA ATAAATAAGCAGAAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 271} {0: 1, 1: 0, 2: 6, 3: 62, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!