ID: 1100586415_1100586418

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1100586415 1100586418
Species Human (GRCh38) Human (GRCh38)
Location 12:95984536-95984558 12:95984555-95984577
Sequence CCAGAAATAGCCACAATGCTATA TATAAAGCAGCACCTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162} {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!