ID: 1100613520_1100613534

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1100613520 1100613534
Species Human (GRCh38) Human (GRCh38)
Location 12:96212529-96212551 12:96212568-96212590
Sequence CCCTGCAATTCCCAGGACTTCTA ATGTTGTTATAGGGGGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156} {0: 1, 1: 0, 2: 0, 3: 26, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!