ID: 1100618398_1100618409

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1100618398 1100618409
Species Human (GRCh38) Human (GRCh38)
Location 12:96249334-96249356 12:96249378-96249400
Sequence CCCAGGATTTCATGACAGCTCAA CGCGCCACTGCGGAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 158} {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!