ID: 1100619095_1100619104

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1100619095 1100619104
Species Human (GRCh38) Human (GRCh38)
Location 12:96254824-96254846 12:96254859-96254881
Sequence CCACTGGTACAGGGTGTTGAAGG CAGGGTAGACAGGGAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101} {0: 1, 1: 3, 2: 10, 3: 86, 4: 932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!