ID: 1100620538_1100620545

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1100620538 1100620545
Species Human (GRCh38) Human (GRCh38)
Location 12:96268027-96268049 12:96268077-96268099
Sequence CCTGGTTTTCTCAGTTTTCCATA CTGTGTCAGTATAAGTAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 616} {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!