ID: 1100665361_1100665363

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1100665361 1100665363
Species Human (GRCh38) Human (GRCh38)
Location 12:96746285-96746307 12:96746308-96746330
Sequence CCTCTGTCATTCTCACAAAACAT CCTTCCAGCCAGACTCCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 265} {0: 1, 1: 0, 2: 0, 3: 10, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!