ID: 1100839072_1100839088

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1100839072 1100839088
Species Human (GRCh38) Human (GRCh38)
Location 12:98593839-98593861 12:98593892-98593914
Sequence CCTCTTTCGAAGGCCGCCGTGAC AGGCCCCGGTTGGGGTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 29} {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!