|
Left Crispr |
Right Crispr |
| Crispr ID |
1100849706 |
1100849714 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:98696473-98696495
|
12:98696502-98696524
|
| Sequence |
CCTACTTCCCAACACTGCCACAG |
TCCAATTTCAACACGAGTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 70, 3: 200, 4: 766} |
{0: 1, 1: 11, 2: 164, 3: 958, 4: 2647} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|