ID: 1100850905_1100850912

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1100850905 1100850912
Species Human (GRCh38) Human (GRCh38)
Location 12:98709963-98709985 12:98710014-98710036
Sequence CCTCCTGGGTTCAAGAGATTCTC TACATGTGTGCTACCACGCATGG
Strand - +
Off-target summary {0: 2061, 1: 50893, 2: 109045, 3: 168761, 4: 180981} {0: 1, 1: 1, 2: 2, 3: 77, 4: 988}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!