ID: 1100869944_1100869947

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1100869944 1100869947
Species Human (GRCh38) Human (GRCh38)
Location 12:98899797-98899819 12:98899840-98899862
Sequence CCAAAATATTAGTTAATTTTTTA CTCTCACATTTATAGCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 142, 4: 1320} {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!