ID: 1100876878_1100876881

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1100876878 1100876881
Species Human (GRCh38) Human (GRCh38)
Location 12:98971562-98971584 12:98971605-98971627
Sequence CCTTTGTCTAGAGTGATCTTATG CTCACCTAACATTCAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90} {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!