ID: 1100878792_1100878803

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1100878792 1100878803
Species Human (GRCh38) Human (GRCh38)
Location 12:98993413-98993435 12:98993455-98993477
Sequence CCCGCCTTGGCCTCCCAAAGTGC CACTGTGCCCAGCCTGTAGTTGG
Strand - +
Off-target summary {0: 56485, 1: 171609, 2: 226607, 3: 184242, 4: 115036} {0: 1, 1: 7, 2: 45, 3: 256, 4: 1181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!