ID: 1100881687_1100881695

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1100881687 1100881695
Species Human (GRCh38) Human (GRCh38)
Location 12:99025549-99025571 12:99025598-99025620
Sequence CCTGGGGTCACTGTAGATAAGCT ATTTGAAATAGGAAAGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74} {0: 1, 1: 0, 2: 2, 3: 39, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!