ID: 1100909295_1100909300

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1100909295 1100909300
Species Human (GRCh38) Human (GRCh38)
Location 12:99339328-99339350 12:99339375-99339397
Sequence CCAGCAATCACTGCATTCTTCCT CCATGCCACACTGCATTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 66, 4: 358} {0: 1, 1: 1, 2: 2, 3: 11, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!