|
Left Crispr |
Right Crispr |
| Crispr ID |
1100971997 |
1100972005 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:100080222-100080244
|
12:100080272-100080294
|
| Sequence |
CCTTGCACCATGTGCCTGGAAAA |
CATGAAAGCAGCCAAGAGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 7, 2: 24, 3: 45, 4: 271} |
{0: 4, 1: 44, 2: 301, 3: 612, 4: 1285} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|