ID: 1100979080_1100979083

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1100979080 1100979083
Species Human (GRCh38) Human (GRCh38)
Location 12:100150682-100150704 12:100150730-100150752
Sequence CCAGCATGTCTAGCTAAAATTTT TTTCACTGTGTTGACCAGGCTGG
Strand - +
Off-target summary No data {0: 117, 1: 4222, 2: 31679, 3: 198252, 4: 327025}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!