|
Left Crispr |
Right Crispr |
| Crispr ID |
1100994214 |
1100994221 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:100284892-100284914
|
12:100284926-100284948
|
| Sequence |
CCAGCCATGGTGGCTCACGCCTG |
CTTTGGAAGGCCAAGGTGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 109, 1: 8358, 2: 46631, 3: 122773, 4: 182014} |
{0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|