ID: 1101016372_1101016377

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101016372 1101016377
Species Human (GRCh38) Human (GRCh38)
Location 12:100505025-100505047 12:100505074-100505096
Sequence CCAGGAACAGCAAACAACTTTGC AACCATGGATTAAGAAATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 146} {0: 1, 1: 0, 2: 5, 3: 59, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!