|
Left Crispr |
Right Crispr |
| Crispr ID |
1101022797 |
1101022799 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:100571078-100571100
|
12:100571099-100571121
|
| Sequence |
CCAAGGAAGAAAGTTTTAATCAG |
AGGTGCTGCAGCTGAAAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 70, 3: 161, 4: 476} |
{0: 1, 1: 3, 2: 46, 3: 148, 4: 453} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|