ID: 1101035859_1101035873

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101035859 1101035873
Species Human (GRCh38) Human (GRCh38)
Location 12:100705807-100705829 12:100705839-100705861
Sequence CCTCCCTTCCTCTCTTCCTTCCC CTTTCTTTTCTGAGGGTGGGAGG
Strand - +
Off-target summary {0: 5, 1: 90, 2: 1238, 3: 9786, 4: 61411} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!