ID: 1101052110_1101052114

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1101052110 1101052114
Species Human (GRCh38) Human (GRCh38)
Location 12:100874246-100874268 12:100874264-100874286
Sequence CCTTCACTGGGGCACTGCCTTGT CTTGTGGAGCTGTGAGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 28, 3: 73, 4: 286} {0: 18, 1: 1782, 2: 2088, 3: 1403, 4: 2996}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!