ID: 1101053531_1101053540

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1101053531 1101053540
Species Human (GRCh38) Human (GRCh38)
Location 12:100888590-100888612 12:100888623-100888645
Sequence CCTTTAGCTCCTTCTTGTGCCTC GGCCAACTGGAGGCCTGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 624} {0: 1, 1: 0, 2: 2, 3: 41, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!