ID: 1101062363_1101062376

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1101062363 1101062376
Species Human (GRCh38) Human (GRCh38)
Location 12:100985611-100985633 12:100985653-100985675
Sequence CCCATCATCTCACTATATTTTAA GAGGGTTCTCTTGGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 390} {0: 1, 1: 0, 2: 1, 3: 34, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!