ID: 1101101071_1101101072

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1101101071 1101101072
Species Human (GRCh38) Human (GRCh38)
Location 12:101393237-101393259 12:101393255-101393277
Sequence CCTCAGAGCTTACATTTCAACAG AACAGTTTAAAGTGCATCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 259} {0: 1, 1: 0, 2: 1, 3: 20, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!