ID: 1101109080_1101109088 |
View in Genome Browser |
Spacer: 14 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1101109080 | 1101109088 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:101468191-101468213 | 12:101468228-101468250 |
| Sequence | CCTCCCTGAGCCTGTTTCTTCAT | TAATTAAGAAAGCAAAGGCTGGG |
| Strand | - | + |
| Off-target summary | {0: 2, 1: 15, 2: 103, 3: 310, 4: 1103} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||