ID: 1101131792_1101131802

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1101131792 1101131802
Species Human (GRCh38) Human (GRCh38)
Location 12:101697756-101697778 12:101697796-101697818
Sequence CCGGCAGTCGCAGGACCCGGCCG CTCTCCCTGCCCCCAGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 232} {0: 1, 1: 1, 2: 15, 3: 146, 4: 1148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!