ID: 1101164082_1101164094

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101164082 1101164094
Species Human (GRCh38) Human (GRCh38)
Location 12:102010203-102010225 12:102010235-102010257
Sequence CCATCCCTGCCGCCTCAGACTTT CCCAGTTCCCAGATGGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 273} {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!