ID: 1101200109_1101200110

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101200109 1101200110
Species Human (GRCh38) Human (GRCh38)
Location 12:102426910-102426932 12:102426930-102426952
Sequence CCTTTGACATTCTTTTTATTCAC CACTGATGTACTTTTGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 456} {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!