ID: 1101225634_1101225639

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1101225634 1101225639
Species Human (GRCh38) Human (GRCh38)
Location 12:102685606-102685628 12:102685645-102685667
Sequence CCAAACTTCACATACAGTGGAAG CTGGGTAAACTGATTGTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!