ID: 1101263789_1101263796

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1101263789 1101263796
Species Human (GRCh38) Human (GRCh38)
Location 12:103063591-103063613 12:103063620-103063642
Sequence CCCTGTGCCACCTGAGGCAACAG CCTTCCCTGAGGCAGTTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 66, 3: 117, 4: 483} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!