|
Left Crispr |
Right Crispr |
| Crispr ID |
1101290672 |
1101290680 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:103364962-103364984
|
12:103364995-103365017
|
| Sequence |
CCTCCCTAAATCATTCTATGAAG |
CCTAATATGAAAACAAGGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 315, 1: 804, 2: 1600, 3: 10539, 4: 4909} |
{0: 1, 1: 1, 2: 14, 3: 148, 4: 905} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|