ID: 1101302255_1101302264

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1101302255 1101302264
Species Human (GRCh38) Human (GRCh38)
Location 12:103495087-103495109 12:103495122-103495144
Sequence CCTCTGGTCTTCCAAGATTCAAT CAGGGAGCAGATGTGGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157} {0: 1, 1: 0, 2: 3, 3: 97, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!