ID: 1101312651_1101312654

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101312651 1101312654
Species Human (GRCh38) Human (GRCh38)
Location 12:103597275-103597297 12:103597295-103597317
Sequence CCATTTCAGAGCTGCTGACGTGG TGGGTCTATCCTTCTTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113} {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!