ID: 1101319135_1101319139

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1101319135 1101319139
Species Human (GRCh38) Human (GRCh38)
Location 12:103657833-103657855 12:103657865-103657887
Sequence CCATCCATCTTAACGGCTTTATC GAGTGCAGGAAATTCCCCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118} {0: 1, 1: 0, 2: 0, 3: 13, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!