ID: 1101323955_1101323964

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1101323955 1101323964
Species Human (GRCh38) Human (GRCh38)
Location 12:103698284-103698306 12:103698327-103698349
Sequence CCTTCTCCTCTCCTTCCCCACAG GATCTCACTAAATTCCATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 194, 4: 1460} {0: 1, 1: 0, 2: 2, 3: 11, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!