ID: 1101328811_1101328814

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1101328811 1101328814
Species Human (GRCh38) Human (GRCh38)
Location 12:103740686-103740708 12:103740710-103740732
Sequence CCGGGAGCGGTGCAGCCTGGTGA ACAGATCCCCAGGTGCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 474} {0: 1, 1: 0, 2: 3, 3: 18, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!