ID: 1101349430_1101349433

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101349430 1101349433
Species Human (GRCh38) Human (GRCh38)
Location 12:103915034-103915056 12:103915083-103915105
Sequence CCTTTATGTTGATAATGGACTTA TTTTCAATCATTAAAGTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 222} {0: 1, 1: 0, 2: 1, 3: 17, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!