ID: 1101353651_1101353657

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1101353651 1101353657
Species Human (GRCh38) Human (GRCh38)
Location 12:103956729-103956751 12:103956744-103956766
Sequence CCGCGGGCATGGTCGGCAGGCTG GCAGGCTGGACGGGGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108} {0: 1, 1: 0, 2: 1, 3: 66, 4: 601}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!