ID: 1101377728_1101377730

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1101377728 1101377730
Species Human (GRCh38) Human (GRCh38)
Location 12:104185168-104185190 12:104185198-104185220
Sequence CCAAATGTTAATAGTGTCAAGGT CCCTGATGCAGATGAAGAAAAGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 53, 3: 160, 4: 442} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!