ID: 1101409626_1101409633

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1101409626 1101409633
Species Human (GRCh38) Human (GRCh38)
Location 12:104457657-104457679 12:104457679-104457701
Sequence CCCAGAGCTCCTGGCTGCCCAGA ATCTACCCGGGTCACCGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 389} {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!