ID: 1101414774_1101414779

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1101414774 1101414779
Species Human (GRCh38) Human (GRCh38)
Location 12:104499507-104499529 12:104499522-104499544
Sequence CCTATAACCTTGGCCTCAGCAAG TCAGCAAGAAAACATTAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 265} {0: 1, 1: 0, 2: 1, 3: 41, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!