ID: 1101419627_1101419637

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101419627 1101419637
Species Human (GRCh38) Human (GRCh38)
Location 12:104539595-104539617 12:104539644-104539666
Sequence CCAGGACACGTTAGGACCCTTGG CCCAAAATTGTCAGCCACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44} {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!