ID: 1101419880_1101419882

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1101419880 1101419882
Species Human (GRCh38) Human (GRCh38)
Location 12:104541986-104542008 12:104542020-104542042
Sequence CCTGCATTTTACTTTCTAGCAAC CTATTTCATTTTTAACATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 202} {0: 1, 1: 0, 2: 7, 3: 68, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!